Archive

10 January 2004, Volume 18 Issue 1 Previous Issue    Next Issue
---
研究报告
研究简报


For Selected:

Download Citations EndNote Ris BibTeX

Toggle Thumbnails

研究报告

Select

Establishment of Module-ESTs System aod Application of cDNA Microarray from Rice ZHUANG Xiao-feng,LI De-bao*,Cabezas DANIEL,DAI Cheng-en,LOU Yi-chun,DONG Hai-tao 2004, 18(1): 1-6 .  Abstract ( )   PDF (486KB) ( )   Module Expressed Sequence Tag (M-EST), a new technology for the research of EST, was described. A cDNA array was spotted out, containing 1985 cDNA fragments that were obtained by using the technology of M-EST. Results showed that the technology was very useful to isolate the target gene, to inspect the expression profile and to investigate the interaction between biological phenotype and expression pattern of gene society. According to the results, it is deemed that M-EST was an important complement and perfection of the concept of EST. It will be an effective measure for using the know-ledge of bioinformatics to improve the velocity of gene isolation and to provide tools for the function research.

Select

Rapid Pyramiding of Resistance Genes to Bacterial Blight in Rice by Using the Integrated Technique of Marker Assisted-Selection and Anther Culture WANG Xing-chun,YANG Chang-deng*,LI Xi-ming,MA Liang-yong 2004, 18(1): 7-10 .  Abstract ( )   PDF (549KB) ( )   WFZ (Wufengzhan 2) and IRBB5, with minor-polygene and a major gene xa5 resistant to bacterial blight respectively, were used as parental lines to pyramid minor-polygene and major genes by using marker assisted-selection, anther culture and backcross. The new piece of R primer, 5′CCAGACACCACTGCACATTC 3′, was designed according to the sequence of RG556 in GeneBank using Primer 3, the new R primer has a similar Tm to the F primer. The PCR efficiency of amplification was greatly improved, about ten times higher than those of the old ones. The individual of B1F1 derived from WFZ 2/IRBB5 showing similar lesion length to WFZ and with gene xa5 were selected for anther culture, sixteen of 30 diploid lines with xa5 incorporated were obtained. These lines showed a higher level of resistance than both of their parents with only 0.1 cm lesion in length. The result showed that the minor-polygene and the major gene were successfully pyramided. It took only two years from the cross to the pyramid, about 1-2 years less than that of the traditional breeding method.

Select

Factors Affecting Rice Transformation Frequency Mediated by Agrobacterium ZHANG Ping ,ZUO Shi-min ,LI Ai-hong ,ZHANG Ya-fang ,CHEN Zong-xiang ,PAN Xue-biao 2004, 18(1): 11-15 .  Abstract ( )   PDF (253KB) ( )   Several important factors influencing transformation frequency of rice mediated by Agrobacterium were investigated with six important indica and japonica rice cultivars. For indica rice, CC medium was the best for callus initiation. Supplying 1.0-2.0 mg/L ABA to the medium could improve the quality of the calli. Adding sorbitol to the subculture medium could improve the growing state of the calli and decrease the percentage of browning calli. For japonica rice, NB medium was the best for callus initiation, but the improvement of the calli quality through adding ABA was not obvious. During the period of subculture, adding some sucrose could improve the situation of hygromycin-resistant calli. Furthermore, the transformation frequency was increased when selection pressure was removed in the stage of plantlet differentiation during the whole hygromycin selection period. Using suitable proportion of hormone combination was beneficial for callus differentiation. The efficient Agrobacterium-mediated transformation system was established in several rice cultivars and a lot of useful transgenic plants were obtained.

Select

QTL Analysis of Grain Shape Traits in Different Environments ZHANG Guang-heng ,ZHANG Guo-ping ,QIAN Qian ,XU Lu-ping ,ZENG Da-li ,TENG Sheng ,BAO Jin-song 2004, 18(1): 16-22 .  Abstract ( )   PDF (270KB) ( )   Quantitative trait loci(QTL) for three grain shape traits including grain length(GL), grain width(GW) and grain length-width ratio (GLW) were mapped in three environments (Beijing, Hangzhou and Hainan). Totally, 18 QTLs were detected for grain shape, locating on chromosome 1, 2, 3, 4, 6, 8 and 12. Three putative QTLs, nine putative QTLs, and six putative QTLs were detected for grain length, grain width, and length-width ratio, respectively. All of these QTLs explained 9.9% to 18.4% phenotypic variation of grain length, 8.4% to 25.6% for grain width, and 9.8% to 22.7% for length-width ratio. The LOD value varied from 2.69 to 4.75 for grain length, from 2.43 to 5.77 for grain width, and from 2.44 to 6.02 for length-width ratio, respectively.

Select

Genetic Analysis of Cold Water Response on Several Agronomic Traits of Rice HAN Long-zhi ,YUAN Dong-lin ,XUAN Ying-shi ,PIAO Zhong-ze ,KOH Hee-jong 2004, 18(1): 23-28 .  Abstract ( )   PDF (238KB) ( )   Difference of cold-water response, general combining ability effects, genetic parameters, correlation among cold-water response index (CRI) of several agronomic traits were analysed by using 45 F 1s obtained from half diallel crosses among 10 rice cultivars.Both general combining ability (GCA) effects and specific combining ability (SCA) effects were highly significant in days to heading, culm length, panicle length, spikelets per panicle, seed setting rate and panicle exsertion.The variance of GCA was much larger than that of SCA in all above traits. Cold-water response index (CRI) of main agronomic traits for Tong 88-7, Gaochan 102 and TR22183 were much larger than those of others, and GCA effects of these varieties on CRI of main agronomic traits were higher than those of others.The frequency of positive and negative alleles, and the proportion of dominant and recessive alleles in the parents for culm length and its CRI were equal. Culm length and its CRI were affected by a few major genes, and these traits had high narrow-sense heritability. CRI for panicle length, spikelets per panicle, seed setting rate and panicle exsertion were positively correlated with CRI of culm length. CRI of seed setting rate was positively correlated with CRI of panicle exsertion.

Select

Quality Characters of Hybrid Rice Grain Derived from Different Ecological Types and Their Genetic Analysis in Japonica Rice (Oryza sativa) LENG Yan,HONG De-lin 2004, 18(1): 29-33 .  Abstract ( )   PDF (195KB) ( )   The performance and inheritance of seven grain quality characters were studied by using F2 rice grain derived from 8×8 diallel crossing made by eight parents of different ecological type japonica rice. The differences in each character of eight parents were not obvious,but in F 2 generation,transgressive phenomena were found in all characters studied,indicating that the genes controlling these characters among parents were scattered. The inheritance of grain width(GW),weight of grain (WG),chalkiness score(CS), gelatinization temperature(GT) and gel consistency(GC) were fitted to additive-dominant model, and dominant effect was major effect in the five characters. The inheritance of grain length(GL)and amylose content(AC) were not fitted to additive-dominant model, existing epistatic effects. Dominant genes for GW and WG made the character values decrease,and dominant genes for CS,GT and GC made the character values increase. Koshihikari contained more recessive genes in GT than other varieties. Zhendao 88 had more dominant genes in GW and WG than other varieties. Xiushui 04 had more dominant genes in GL and GC and more recessive genes in CS than other varieties.

Select

Development of a Greenable Leaf Colour Mutant Baifeng A and Its Application in Hybrid Rice Production SHEN Sheng-quan,SHU Qing-yao,BAO Jin-song,WU Dian-xing,CUI Hai-rui,XIA Ying-wu 2004, 18(1): 34-38 .  Abstract ( )   PDF (202KB) ( )   A greenable leaf colour mutant, Baifeng A, was screened and developed after a series of backcrosses from Ⅱ32B with gamma ray irradiation. Baifeng A was an albino during the first three leaves growth stage, especially the first two leaves, the leaf colour began to turn back to green at the fourth leaf. Genetic analysis indicated that the leaf colour mutant was controlled by a single recessive gene. Baifeng A had similar flower organs and sterility characters and kept high combination ability as its parent Ⅱ32A. The growth speed of Baifeng A was slower than that of its parent when sown in either high or low density, but the mutant could survive under competition. Simulation test of hybrid rice production demonstrated that the purity of hybrid rice would be improved greatly by using leaf colour as a marker to eliminate the false hybrid rice at early stage.

Select

Characters of Resistance to Rice Sheath Blight of Zhongda 2, a Transgenic Rice Line Modified by Chitinase Gene(RC24) YUAN Hong-xu ,XU Xin-ping ,ZHANG Jian-zhong ,GUO Jian-fu ,LI Bao-jian 2004, 18(1): 39-42 .  Abstract ( )   PDF (656KB) ( )   The transgenic rice Zhongda 2, genetically modified from a indica rice cultivar Zhuxian B by rice chitinase gene (RC24), had high resistance to rice sheath blight (Rhizoctonia solani) in laboratory and a two-year field experiment. The pathogen could infect the sheath of Zhongda 2 and induce symptom of the disease. There was no difference in time of penetration or incubation period between Zhongda 2 and non-transgenic rice control, Zhuxian B, but the melting hypha was observed early compared with the control. Resistance of Zhongda 2 showed to inhibit the growth of mycelium in host tissue. The preliminary study on resistance of hybrid rice combinations (F1) of Zhongda 2(♂) crossed withother five non-transgenic rice materials showed that the resistance of F1 generations were higher than those of non-transgenic maternal parents, but they also changed along with the different maternal parents.

Select

Resistance of Transgenic Rice Containing Both sck and cry1Ac Genes Against Chilo suppressalis and Cnaphalocrocis medinalis LI Dong-hu ,FU Qiang ,WANG Feng ,YAO Qing ,LAI Feng-xiang ,WU Jin-cai ,ZHANG Zhi-tao 2004, 18(1): 43-47 .  Abstract ( )   PDF (230KB) ( )   The resistance of two transgenic rices,MSB and MSA containing sck and cry1Ac genes against Chilo suppressalis and Cnaphalocrocis medinalis, two destructive lepidopteran pests of rice in China, was evaluated under both laboratory and field conditions. The results in vitro laboratory bioassay showed that MSB and MSA exhibited high resistance against the two pests, which was influenced by the age of rice plants. The corrected mortality of the two pests were 98.9%-100% on 65-71 days old transgenic rices, and declined in some extent on 105-109 days old ones. However, except the corrected mortality of C. suppressalis on MSB (as high as 79.3%) decreased markedly (P<0.05), those of C . suppressalis on MSA and C . medinalis on both MSB and MSA (92.8%-98.1%) did not decrease significantly. MSB tested in field also showed high resistance to the two pests. There was no significant difference between MSB and the resistant control “Kemingdao 1” (containing a cry1Ab gene). MSB showed a little better controlled effect on the two pests in comparison with its parent control Minghui 86 with insecticides treatment. Compared with Minghui 86 without insecticides treatment, control effects of MSB on the two pests were 92.6% and 97.3%, respectively, while those of insecticides treated Minghui 86 were 87.7% and 89.8%.

Select

Biochemical and Physiological Characteristics in Seedlings Roots of Different Rice Cultivars under Low-Phosphorus Stress LI Feng,LI Mu-ying,PAN Xiao-hua*,ZHU An-fan 2004, 18(1): 48-52 .  Abstract ( )   PDF (207KB) ( )   With sandy culture, effect of low-phosphorus stress on membrane lipid peroxidation, protective enzyme system activity, and acid phosphatase(Apase) activity in rice seedlings roots of low-phosphorus-tolerant cultivars(Dalidao,Liantangzao 3) and low-phosphorus-sensitive cultivars(Huzhanqi, Xinshanbaili) were analyzed. Low-phosphorus stress aggravated the membrane lipid peroxidation in rice roots, enhanced SOD, CAT, POD and Apase activities. In low-phosphorus-tolerant cultivars, protective enzyme activity increased more greatly, while MDA and Apase activities less severely than those in low- phosphorus-sensitive cultivars.

Select

Growth and Developmental Characteristics of Rice Cultivated in Aerobic Soil Mulched with Straw SHENG Hai-jun ,ZHOU Chun-lin ,SHEN Qi-rong ,XU Yang-chun ,FENG Ke 2004, 18(1): 53-58 .  Abstract ( )   PDF (224KB) ( )   Some characteristics of rice cultivated in aerobic soil mulched with semi-decomposed straw and plastic film and without any mulch were compared under field conditions. During the period of rice growth with about 440 mm precipitation, the rice grew and developed much better at middle and later stages in the soil mulched with straw than under the other two cultivation treatments. The yield components of rice grown in soil with straw mulched, such as filled grains per panicle and 1000-grain weight, were improved significantly compared with those under the other aerobic cultivation treatments.

Select

Change Law of Hyperspectral Data with Chlorophyll and Carotenoid for Rice at Different Developmental Stages TANG Yan-lin ,HUANG Jing-feng ,WANG Ren-chao 2004, 18(1): 59-66 .  Abstract ( )   PDF (317KB) ( )   The hyperspectral reflectances of the canopy, the first and the third unfolding leaf from the top and panicles of two rice varieties were measured by a ASD FieldSpec Pro FR TM in field and indoor under three nitrogen levels at different developmental stages.The concentrations of chlorophyll and carotenoid in leaves and panicles corresponding to the spectra were determined by biochemical method. The spectral differences were significant for the canopies and leaves of rice under different nitrogen levels, and the concentrations of chlorophyll and carotenoid of leaves increased along with nitrogen application increased. There were significant differences in the pigment concentrations of the rice leaves under different nitrogen levels. The spectral reflectance of the canopy was gradually getting smaller in the visible region and bigger in the near infrared region as the growth stages goes on before heading stage, but with reverse change after heading stage. There existed “blue shift” phenomena for the position of red edge of the spectra of canopies, leaves and panicles after heading stage. The concentrations of chlorophyll and carotenoid of leaves presented S-shape change. The concentrations of chlorophyll and carotenoid of canopies, leaves and panicles were very significantly correlative to the hyperspectral vegetation indices R990/R553, R1200/R553, R750/R553, R553/R670, R800/R553, PSSRa (R800/R680), PSNDa[(R800-R680)/(R800+R680)][R denotes reflectance, number in subscript is wavelength (nm)] and the red edge position λ red. This indicated that these vegetation indices could be used to estimate the concentrations of chlorophyll and carotenoid of canopies, leaves and panicles of rice.

Select

Effects of Bensulfuron-methyl on Soil Microbial Activity and Biochemical Characteristics in Paddy XIE Xiao-mei ,LIAO Min ,HUANG Chang-yong ,LIU Wei-ping 2004, 18(1): 67-72 .  Abstract ( )   PDF (255KB) ( )   Under submerged incubation with different bensulfuron-methyl treatments (0-750 g/hm2), dynamics of soil microbial activity and biochemical characteristic in a waterlogged paddy soil were studied. Slow decrease in the soil microbial biomass (phospholipid content) was found with the prolongation of incubation time in all treatments, while the soil microbial biomass (phospholipid content) decreased with increasing of herbicide bensulfuron-methyl level against control. A consistent decline in the abundance of heterotrophic bacteria was observed with the continuance of incubation in all treatments, while the abundance of heterotrophic bacteria rapidly decreased with increasing of bensulfuron-methyl level against control, especially at higher levels (375 and 750 g/hm2). A consistent decrease in soil electron transport system (ETS)/dehydrogenase activity was found during first week in all treatments, while later on it increased. Soil electron transport system activity also decreased with increasing of herbicide bensulfuron-methyl level against control. A consistent increase in soil phenol content was measured during first week in all treatments, while later on it decreased. Soil phenol content rapidly increased with increasing of herbicide bensulfuron-methyl level against control, especially at higher levels (375 and 750 g/hm2). A consistent but non- significant depletion in the soil protein content was noticed with the prolongation of incubation period in all treatments, while a slight but consistent (non-significant) increase in the soil protein content was observed with the increased herbicide concentration irrespective of the incubation stage.

Select

Monitoring of Insecticide Resistance and Inheritance Analysis of Triazophos Resistance in the Striped Stem Borer (Lepidoptera: Pyralidae ) CAO Ming-zhang,SHEN Jin-liang*,ZHANG Jin-zhen,LU Mei,LIU Xiao-yu,ZHOU Wei-jun 2004, 18(1): 73-79 .  Abstract ( )   PDF (279KB) ( )   During 2001 and 2002, resistance to four insecticides in different populations of striped stem borer, Chilo suppressalis (Walker), collected from Zhejiang, Jiangsu, Anhui and Jiangxi Provinces, was monitored by topical application. Low level of resistance to fipronil (6.5-fold) was detected in Rui’an population from southeast Zhejiang, which is the first documentation of fipronil resistance in this pest insect, but other six populations tested remained susceptible to this newly introduced insecticide though some susceptibility variation existed. No apparent resistance to abamectin had been detected after examining six populations from Zhejiang, Jiangsu and Anhui Provinces, with susceptibility variation among them less than 2.3-fold. Great difference of susceptibility to triazophos was found in ten populations from the four provinces, with very high level of resistance (163.1-fold) in Rui’an population, moderate in Wenzhou (Zhejiang) population (18.2-fold), and low in populations of Changshu, Xishan and Jintan in south Jiangsu (6.7- to 9.7-fold), but the other five populations were susceptible. All nine populations monitored were resistant to monosultap with varying degrees, high level of resistance occurred in Rui’an and Yifeng (Jiangxi) populations (113.7- and 57.6-fold, respectively), moderate in Wenzhou, Changshu, Jintan and Taihu populations (11.0- to 29.7-fold), low in Xinyang and Xishan populations (6.7- and 7.5-fold, respectively), and the lowest level of resistance in Guanyun population (3.7-fold). Inheritance of triazophos resistance in Rui’an resistant strain selected with triazophos in laboratory was studied through reciprocal cross and backcross experiments. Preliminary results indicated that inheritance of resistance to triazophos in Rui’an strain was incompletely dominant,with degree of dominance (D) being 0.46 and 0.68 for reciprocal crosses, respectively, and the resistance was controlled by a single major gene, though minor modifying genes might be involved.

研究简报

Select

Analysis on Grain Quality of New Hybrid Rice Combinations in Sichuan Province JIANG Kai-feng ,ZHENG Jia-kui ,ZHAO Gan-lin ,YANG Qian-hua ,WAN Xian-qi ,WANG Xu-dong 2004, 18(1): 80-82 .  Abstract ( )   PDF (138KB) ( )   Some grain quality traits of 25 new hybrid rice combinations in regional trial of Sichuan Province in 2001 were analyzed. According to Standard for Fine Quality Rice, by Ministry of Agriculture, China (NY/T83-1988), no combination reached the 2nd class standard of chalky rice rate, and the combinations reached the 1st class standard in gel consistency were rare. The correlations between chalky rice rate and chalky area, amylose content and chalky rice rate were significantly positive at 1% and 5% levels, respectively. The correlation between amylose content and chalky area was significantly negative at 5% level, and the correlations between grain yield and gel consistency, grain yield and amylose content were significantly positive at 5% level, respectively. It suggested that, in order to obtain desirable grain quality in hybrid rice, it was necessary to reduce chalky rice rate and chalky area and increase gel consistency; and to properly increase 1000-grain weight in hybrid rice might be considered in good grain quality and high yielding rice breeding.

Select

Virulence Differentiation of Xanthomonas oryzae pv. oryzicola in Southern Region of China GUO Ya-hui ,XU Zhi-gang ,HU Bai-shi,SHEN Xiu-ping,CHEN Zhi-yi ,LIU Yong-feng 2004, 18(1): 83-85 .  Abstract ( )   PDF (131KB) ( )   The virulence differentiation of 62 isolates of X. oryzae pv. oryzicola collected from different areas in southern China were identified based on strain-cultivar interaction by using 28 varieties with different resistance genes. Flag leaves at booting stage were inoculated with selected strains by needle puncture. It showed that the virulence of strains were differentiated distinctly. Weak interaction patterns were found mainly between bacterial isolates and rice varieties, but there were specific interaction significantly. It was suggested that the X.oryzae pv. oryzicola could be divided into six race groups, the interaction patterns on six differential varieties were RRRRRS, RRRRSS, RRRSSS, RRSRSS, RRSSSS, and RSSSSS.

Select

Effect of NSP Enzymes Supplementation on Digestion of Early Rice Grain and Brown Rice in Vitro LI Wei-fen,YU Song-dong,SUN Jian-yi* 2004, 18(1): 86-88 .  Abstract ( )   PDF (151KB) ( )   The digestive experiment in vitro showed that, non- starch polysaccharide (NSP) enzymes significantly increased the digestibility of dry matter, crude protein, ether extract and crude fiber in early rice grain by 16.29%, 9.10%, 10.11% and 92.07% and in brown rice by 27.46%, 26.41%, 20.67% and 7.16%, respectively. The digestibility of amino acid in early rice grain and in brown rice were increased by 9.48-40.79% and 7.93-41.74%, respectively. Moreover, NSP enzymes could enhance glucose and total amino acid content by 69.39% and 88.51% and by 11.52% and 11.83% in digestive filtration solution of rice grain and brown rice, respectively.